Advertisement

Prevalence of HLA-B*57:01 allele in HIV-positive and HIV-negative population of eastern India: An epidemiological study

Open AccessPublished:November 17, 2022DOI:https://doi.org/10.1016/j.cegh.2022.101181

      Abstract

      Introduction

      The nucleoside analogue reverse-transcriptase inhibitor Abacavir has potent antiviral activity against HIV; however, 5–8% patients develop hypersensitivity reactions within six weeks of treatment. The presence of the HLA-B*57:01 allele is strongly associated with the risk of Abacavir-associated hypersensitivity reaction (ABC-HSR). Prevalence of HLA-B*57:01 allele varies in different populations. This observational study was performed to determine the prevalence of HLA-B*57:01 allele in the population of Eastern India which included both HIV-positive and HIV-negative subjects.

      Methods

      We screened 406 subjects attending the ART (antiretroviral treatment) centre and linked ICTC (Integrated counselling and testing centre), however 6 samples did not have adequate DNA. HLA-B*57:01 typing was done using direct sequence specific primer PCR (SSP-PCR). All PCR positive samples were sequenced using Sanger's method.

      Results

      The prevalence of HLA-B*57:01 genotype in our cohort was 12.25% (49/400). Prevalence among men was 13.3% (33/248) and female was 10.5% (16/152). The prevalence was similar in HIV-positive subjects (13.5%) and in HIV-negative subjects (11%).

      Conclusions

      Prevalence of HLA-B*57:01 in our eastern Indian population was high. Therefore, screening for HLA-B*57:01 before ABC administration would be useful to prevent ABC-HSR.

      Keywords

      1. Introduction

      The National AIDS control program was providing free Antiretroviral therapy to 9,97,000 adult PLHIV (people living with HIV) and 55,606 CLHIV (children living with HIV) till September 2016.
      The National program has implemented the “Treat All” strategy, which recommends starting treatment for all PLHIV & CLHIV which will increase the number of PLHIV/CLHIV on treatment many folds. Abacavir (ABC) a guanosine analogue reverse transcriptase inhibitor is currently recommended as a part of first line regimen by National AIDS control Organization (NACO), India for children with haemoglobin <9 g/dl and as an alternate first line regimen for adults who have adverse effects with Tenofovir. It is an excellent drug in term of efficacy however, can cause a potentially life-threatening hypersensitivity reaction (HSR) in 5–8% patients within 4–6 weeks of treatment. Studies have shown a strong association between ABC-HSR and the major histocompatibility (MHC), HLA class I allele, HLA-B*57:012. To avoid this HSR, routine screening for HLA-B*57:01 is recommended in resource rich setting before start of therapy and abacavir is only prescribed if a patient tests negative.
      • Hetherington S.
      • Hughes A.R.
      • Mosteller M.
      • et al.
      Genetic variations in HLA-B region and hypersensitivity reactions to abacavir.
      The prevalence of HLA-B*57:01 allele varies among different ethnicity.
      • Hughes A.R.
      • Mosteller M.
      • Bansal A.T.
      • et al.
      Association of genetic variations in HLA-B region with hypersensitivity to abacavir in some, but not all, populations.
      Among Caucasians, the prevalence was 7.93% whereas among those of African origin only 0.26%.
      • Orkin C.
      • Sadiq S.
      • Rice L.
      • Jackson F.
      • team U.E.
      Prospective epidemiological study of the prevalence of human leukocyte antigen (HLA)‐B* 5701 in HIV‐1‐infected UK subjects.
      The reported prevalence of HLA-B*57:01 in East Asian populations was lower than 0.3% among Koreans and Taiwanese, 3.4–4% in children from Thailand and Cambodia.
      • Sun H.-Y.
      • Hung C.-C.
      • Lin P.-H.
      • et al.
      Incidence of abacavir hypersensitivity and its relationship with HLA-B* 5701 in HIV-infected patients in Taiwan.
      ,
      • Puthanakit T.
      • Bunupuradah T.
      • Pope Kosalaraksa U.V.
      • et al.
      Prevalence of human leukocyte antigen-B* 5701 among HIV-infected children in Thailand and Cambodia: implications for abacavir use.
      The prevalence of this allele varies between 1.92 - 11% in various studies from India. While it is 1.92% among North Indian Hindus,
      • Balakrishnan K.
      • Pitchappan R.
      • Suzuki K.
      • Kumar U.S.
      • Santhakumari R.
      • Tokunaga K.
      HLA affinities of Iyers, a Brahmin population of Tamil Nadu, south India.
      5.33–5.91% in Western India,
      • Umapathy S.
      • Pawar A.
      • Ghosh K.
      Specific human leukocyte antigen alleles associated with HIV-1 infection in an Indian population.
      8.2% among Nadar, Tamilians and 3.19% in other South Indians
      • Shankarkumar U.
      • Sridharan B.
      • Pitchappan R.
      HLA diversity among Nadars, a primitive Dravidian caste of South India.
      ,
      • Dedhia L.
      • Gadekar S.
      • Mehta P.
      • Parekh S.
      HLA haplotype diversity in the South Indian population and its relevance.
      and 11% in HIV positive children from Mumbai.
      • Manglani M.V.
      • Gabhale Y.R.
      • Lala M.M.
      • Sekhar R.
      • More D.
      HLA-B* 5701 allele in HIV-infected Indian children and its association with abacavir hypersensitivity.
      At present there are no studies on the prevalence of this allele in eastern India. Thus, the main objective of the study was to determine the prevalence of HLA-B*57:01 allele in population of Eastern India which included both HIV-positive and HIV-negative subjects.

      2. Methods and material

      2.1 Study settings, design, period & population

      This observational study was conducted between 2013 and 2016 in the Antiretroviral Therapy (ART) Centre of Department of Medicine, Institute of Medical Sciences (IMS), Banaras Hindu University (BHU), India. The source population were all HIV-positive adults attending ART centre and subjects testing HIV- negative in the linked ICTC centre who were fulfilling the inclusion criteria. The participants were from 15 districts of Eastern Uttar Pradesh Ambedkar nagar (6), Allahabad (5), Azamgarh (51), Ballia (42), Bhadoi (17), Chandoli (34), Deoria (11), Ghazipur (28), Gorakhpur (2), Jaunpur (37), Mau (31), Mirzapur (38), Pratapgarh (1), Sonebhadra (19), Varanasi (78).

      2.2 Inclusion and exclusion criteria

      Inclusion Criteria.
      • 1.
        Participate above the age of 18 years.
      • 2.
        Residing in eastern Uttar Pradesh and willing to participate in the study.

      2.3 Sample size determination and sampling technique

      As the prevalence of HLA-B*57:01 allele in different Indian population varied from 1.92-8.2%
      • Shankarkumar U.
      • Sridharan B.
      • Pitchappan R.
      HLA diversity among Nadars, a primitive Dravidian caste of South India.
      ,
      • Dedhia L.
      • Gadekar S.
      • Mehta P.
      • Parekh S.
      HLA haplotype diversity in the South Indian population and its relevance.
      we assumed 4% prevalence of this allele in eastern Indian population having similar ethnic characteristics which included both HIV positive and negative adults as the HLA-B*57:01 allele doesn't vary with HIV status. Using 2% precision, the sample size was calculated by the formula n = (z)
      • Mallal S.
      • Nolan D.
      • Witt C.
      • et al.
      Association between presence of HLA-B* 5701, HLA-DR7, and HLA-DQ3 and hypersensitivity to HIV-1 reverse-transcriptase inhibitor abacavir.
      p q/d2 where n = sample size, z = level of confidence according to the standard normal distribution (for a level of confidence of 95%, z = 1.96, p = estimated proportion of the population that presents the characteristic (p = 0.04 assumed that the prevalence is same in both HIV positive and negative adults), d = tolerated margin of error. The sample size was calculated to be 369 subjects. Considering, the 10% wastage of samples, it was increased to 406 subjects. A list (sampling frame) was prepared of HIV-positive adults attending ART centre and subjects testing HIV-negative in the linked ICTC centre.

      2.4 Data collection tools & procedures

      Baseline data of CD4 count, WHO stage and opportunistic infection of the HIV-positive participants were taken from database of the ART centre. Demographic data were collected for HIV-negative adults participating in the study in the ART centre. CD4+ lymphocyte counts (BD FACS Calibur) were available only for HIV-positive subjects as it is done routinely as per NACO guidelines and the values were expressed as cells/μL.

      2.5 Sample collection and DNA extraction

      Whole blood samples from each subject (2.5 ml) were collected in an EDTA vial. Separation of buffy coat from whole blood was done by centrifugation at 2500 rpm for 10 minutes at 4 °C. Buffy coat was transferred in to a sterile polypropylene tube and stored at −20 °C till DNA extraction. DNA was extracted from the buffy coat using QIAamp DNA Blood Mini Kit (QIAGEN, Hilden, Germany) according to manufacturer's protocol and stored at −20 °C until further processing. The quality and quantity of DNA was checked by agarose gel electrophoresis and NanoDrop (Thermo Scientific, USA).

      2.6 HLA B*57 allele specific amplification by PCR

      In the HLA B*57 database, that highest variability in SNPs is observed in the exon 2 and exon 3 region which are peptide-binding domains of the MHC class I molecule.
      • Robinson J.
      • Halliwell J.A.
      • McWilliam H.
      • Lopez R.
      • Parham P.
      • Marsh S.G.
      The imgt/hla database.
      Therefore, we selected primer targeting exon-3-region for high resolution HLA B*57 typing. HLA B*57 exon 3 region was amplified by sequence-specific primer (SSP). The primers used for HLA B*57 amplification in the study were as follows: Primer F: 5′-GTCTCACATCATCCAGGT-3′ and primer R: 5′-CGTCTCCTTCCCGTTCTC-3′ (Eurofins Genomics India Pvt Ltd) which amplifies a 262bp amplicon. The reaction mixture was prepared in a total volume 25 μl containing 2 μl of the extracted DNA (50 ng/μl) along with 12.5 μl Dream Taq Green PCR master mix (Thermo Scientific, USA) and the primers 1 μl each (10 pmol/μl each). DNase/RNase free water was used to make up the final volume. The presence of human genomic DNA was evaluated by Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) housekeeping gene as internal control. The primers used for GAPDH amplification as follows: Primer GAPDH-F (5′-GGCAGCAGCAAGCATTCCT-3′) and primer GAPDH-R (5′-GCCCAACACCCCCAGTCA-3′) which amplifies a 136bp amplicon.
      • Lin C.-Y.
      • Chen H.-C.
      • Lin R.-W.
      • et al.
      Quality assurance of genotyping array for detection and typing of human papillomavirus.
      The mixture was subjected to 35 cycles of amplifications using Veriti 96 Well Thermal Cycler (Applied Biosystems, USA). Each cycle included a denaturation step at 94 °C for 30 seconds, an annealing at 55 °C for 45 seconds, and a chain elongation step at 72 °C for 30 s.
      • Cascella R.
      • Strafella C.
      • Ragazzo M.
      • et al.
      Direct PCR: a new pharmacogenetic approach for the inexpensive testing of HLA-B* 57: 01.
      PCR products were then electrophoresed on 1.4% agarose gel stained with GoodViewTM Nucleic Acid stain, and amplicons were viewed and photographed by using the Gel Doc 2000 gel documentation system (Bio-Rad) under UV light using Alpha Innotech Gel documentation system.

      2.7 HLA-B*57:01 sequencing

      The samples positive by direct PCR were subsequently sequenced using Sanger's method after DNA extraction from the agarose gel in order to establish the correct genotype. After kit-based purification, DNA sequencing was performed on conventional ABI 3130 with the same primers used for HLA B*57 amplification, at Centre for Genetic Disorders (CGD) at Faculty of Science, BHU. Data was analysed first in finchTV Software for SNP detection and then matched with IMGT (HLA-B*57) data Clustal W software for multiple alignment.
      Reference Sequences IMGT: HLA-B*57:01data (Exon 3)
      GGTCTCACATCATCCAGGTGATGTATGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGTGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGG.

      2.8 Data analysis

      Statistical analysis was performed using the Statistical Package for Social Sciences (SPSS) software, version 16. The proportions were compared using Chi-square test or Fisher's Exact test. We used t-test for parametric data and Mann–Whitney test for non-parametric data. The prevalence of the allele in HIV positive and negative participants was compared using 2-sample proportions test.

      3. Results

      3.1 Sociodemographic and clinical characteristics

      We screened 406 HIV-positive and HIV-negative subjects from 15 districts of Eastern India however in six samples, quality of DNA was inadequate and the data presented here is of 400 participants. Baseline characteristics of all 400 subjects are given in (Table 1). Among the HIV-positive individuals, 66% were in WHO stage I and the median baseline CD4 count were 151cells/μl, 23 had Tuberculosis, 3 had Pneumonia, 7 had chronic diarrhoea and 4 had oral and oesophageal candidiasis. Direct PCR for HLA-B*57 was positive in 49/400 subjects (Fig. 1). All direct PCR positive samples were sequenced for HLA typing. All positive samples were “heterozygous” each patient carrying one copy of the HLA-B*57:01 allele. Output of sequence in finchTV Software showed excellent chromatogram peaks of HLA-B*57:01 allele in all positive samples (Fig. 2). Thus, the overall prevalence of HLA-B*57:01 genotype in our cohort was 12.25% (49/400). Prevalence of HLA-B*57:01 genotype in men was 13.3% (33/248) and in female was 10.5% (16/152). The prevalence in HIV-positive subjects was 13.5% and in HIV-negative subjects was 11%. However, there was no significant difference between the proportions in HIV positive and negative groups (p = 0.446).
      Table 1Baseline characteristics of HIV-positive and HIV-negative subjects.
      VariablesHIV-positive (N = 200)HIV-negative (N = 200)
      HLAB
      Mann whitney.
      57:01 Positive carrier (n = 27)
      HLA-B
      Mann whitney.
      57:01 Negative Carrier (n = 173)
      P-valueHLA-B
      Mann whitney.
      57:01 Positive carrier (n = 22)
      HLAB
      Mann whitney.
      57:01 Negative Carrier (n = 178)
      P-value
      Age in years Median (IQR)36 (28–45)35 (30–40)0.656
      Mann whitney.
      38.5 (27–54.3)35 (24–50)0.567
      Mann whitney.
      Sex
       Male20 (74.1%)102 (59.0%)0.134
      Chi-square.
      13 (59.1%)113 (63.5%)0.687
      Chi-square.
       Female7 (25.9%)71 (41.0%)9 (40.9%)65 (36.5%)
      CD4 count(ul) Median (IQR)168 (95–268)150 (67–244)0.463
      Mann whitney.
      WHO Stage
       I15 (57.7%)106 (61.3%)0.138
      Chi-square.
       II0 (0%)12 (6.9%)
       III8 (30.8%)26 (15%)
       IV3 (11.5%)29 (16.8%)
      Duration of ART Median (month)44 (18–77)38 (22–63)0.757
      Mann whitney.
      a Chi-square.
      b Mann whitney.
      Fig. 1
      Fig. 1Gel electrophoresis of direct HLA-B57:01 products M: ladder (50bp), Lane 2–11; B57* positive and B57* negative samples (262bp), GAPDH (136bp) and Negative control (NC).
      Fig. 2
      Fig. 2Output of Sequence in FinchTV Software shows chromatogram peaks of HLA- B*57:01 allele positive sample.

      4. Discussion

      This is the first study reporting the prevalence of HLA-B*57:01 allele in HIV-positive and HIV-negative subjects in Eastern Indian population. The overall prevalence of HLA-B*57:01 Allele in this population was quite high at 12.25%. The prevalence was much higher than Japan 1%, East Asians 1–4%, Sub-Saharan Africa <1%, American Caucasians, Australia, UK and Western Europe 5–10%.
      • Pavlos R.
      • Mallal S.
      • Ostrov D.
      • Pompeu Y.
      • Phillips E.
      Fever, rash, and systemic symptoms: understanding the role of virus and HLA in severe cutaneous drug allergy.
      The prevalence is also higher than most of the studies from India except for a recent study from Mumbai where the prevalence was 11% in HIV-positive children
      • Manglani M.V.
      • Gabhale Y.R.
      • Lala M.M.
      • Sekhar R.
      • More D.
      HLA-B* 5701 allele in HIV-infected Indian children and its association with abacavir hypersensitivity.
      given in Table 2.
      Table 2HLA-B*57 allele frequencies (AF) in Indian populations.
      PopulationHLA-B*57 Allele carrier FrequencySample sizeYearReferences
      North Hindus1.92%521996
      • Dedhia L.
      • Gadekar S.
      • Mehta P.
      • Parekh S.
      HLA haplotype diversity in the South Indian population and its relevance.
      Northern Indian3.8%522002
      • Rajalingam R.
      • Krausa P.
      • Shilling H.G.
      • et al.
      Distinctive KIR and HLA diversity in a panel of north Indian Hindus.
      Southern Indian (Nadar)8.2%712003
      • Shankarkumar U.
      • Sridharan B.
      • Pitchappan R.
      HLA diversity among Nadars, a primitive Dravidian caste of South India.
      Western Indian5.33%752007
      • Umapathy S.
      • Pawar A.
      • Ghosh K.
      Specific human leukocyte antigen alleles associated with HIV-1 infection in an Indian population.
      Mumbai11.25%402008
      • Shankarkumar U.
      • Pawar A.
      • Gaonkar P.
      • Parasannavar D.
      • Salvi V.
      • Ghosh K.
      HLA allele associations in idiopathic recurrent spontaneous abortion patients from India.
      Northern Indian (Delhi, Uttar Pradesh, Haryana and Punjab)9.9%912007
      • Rani R.
      • Marcos C.
      • Lazaro A.
      • Zhang Y.
      • Stastny P.
      Molecular diversity of HLA‐A,‐B and‐C alleles in a North Indian population as determined by PCR‐SSOP.
      New Delhi7.0%712011
      • Gonzalez-Galarza F.F.
      • Christmas S.
      • Middleton D.
      • Jones A.R.
      Allele frequency net: a database and online repository for immune gene frequencies in worldwide populations.
      Andhra Pradesh5.8%1102001
      • Crawford M.H.
      • Reddy B.M.
      • Martinez-Laso J.
      • Mack S.J.
      • Erlich H.A.
      Genetic variation among the Golla pastoral caste subdivisions of Andhra Pradesh, India, according to the HLA system.
      Mumbai5.91%902012
      • Kankonkar S.
      • ShankarKumar U.
      Molecular diversity of HLA-A, HLA-B, HLA-DRB1 and HLA-DQB1 alleles from Mumbai India.
      Western India- Mumbai3.69%2032013
      • Chaudhari D.V.
      • Chavan V.R.
      • Ahir S.P.
      • Kerkar S.C.
      • Mehta P.R.
      • Mania-Pramanik J.
      Human leukocyte antigen B distribution in HIV discordant cohort from India.
      Tamil Nadu (Iyers)7.8%741996
      • Balakrishnan K.
      • Pitchappan R.
      • Suzuki K.
      • Kumar U.S.
      • Santhakumari R.
      • Tokunaga K.
      HLA affinities of Iyers, a Brahmin population of Tamil Nadu, south India.
      South Indian (5 linguistic groups Kannada, Malayalam, Tamil, Telugu & Tulu)3.19%722015
      • Dedhia L.
      • Gadekar S.
      • Mehta P.
      • Parekh S.
      HLA haplotype diversity in the South Indian population and its relevance.
      Mumbai (HIV-positive Children)11%1002018
      • Manglani M.V.
      • Gabhale Y.R.
      • Lala M.M.
      • Sekhar R.
      • More D.
      HLA-B* 5701 allele in HIV-infected Indian children and its association with abacavir hypersensitivity.
      Screening for HLA-B*57:01 is mandatory in developed countries before starting abacavir.
      • Sooda A.
      • Rwandamuriye F.
      • Wanjalla C.N.
      • et al.
      Abacavir inhibits but does not cause self-reactivity to HLA-B* 57: 01-restricted EBV specific T cell receptors.
      However, in the National program of India screening is not done due to resource constraints and abacavir is stopped on clinical suspicion of abacavir hypersensitivity. There are very few studies on abacavir hypersensitivity from India. During the study period 101 children in our centre were started on abacavir, out of which 8 [7.9% (95% CI 3.5–15.0%)] children developed clinically diagnosed abacavir HSR and the drug was stopped. On testing for HLA-B*57:01 in these 8 children only 2 of them were HLA-B*57:01 allele positive. Four of these 8 children with clinical Abacavir hypersensitivity had concomitant illness which can be easily confused with ABC-HSR and it was suggested that in the absence of HLA-B*57:01 testing in the program, treating concomitant illness prior to starting therapy in children will prevent unnecessary discontinuation of abacavir.
      • Chakravarty J.
      • Sharma S.
      • Johri A.
      • Chourasia A.
      • Sundar S.
      Clinical abacavir hypersensitivity reaction among children in India.
      The other option is to provide other antiretroviral drugs e.g., pediatric tenofovir in the program as first line so that use of abacavir in children is minimized.

      5. Conclusion

      High prevalence of HLA-B*57:01 allele in our population highlights risks towards the Abacavir Hypersensitivity Reaction (ABC HSR). Therefore, HIV-infected patients should be continuously screened before starting Abacavir therapy.

      5.1 Limitations

      The limitation of our study is the use of sequence-based genotyping the current gold standard for detection of HLA-B*57:01 allele carriers. This method is labour intensive, requires specialized laboratories, thus limiting its use in a resource poor setting like India. The need of the hour is development of simpler methods of detection of this allele without the use of sequence-based genotyping which can be implemented in resource poor settings.

      Ethical consideration

      The study was approved from the institutional review ethics committee of the IMS, Banaras Hindu University, under Dean/2013-14/EC/356 and written informed consent was obtained from all the participants. Participants were assured that their confidentiality would be maintained both during and after the study. Information given was used only for the purpose of this study.

      Availability of data and materials

      Most of the data is included in the manuscript. Additional can be found from the corresponding author based on reasonable request.

      Source of funding

      This work was supported by the Centre of Excellence (COE), NACO (M-18017/72/2007/NACO (GF Rd 6), and Uttar Pradesh State AIDS Control Society (UPSACS). Author AG1is the recipient of UGC-Rajiv Gandhi National Fellowship (RGNF) financial support as Junior Research Fellow (JRF), India (Award no-201314-RGNF-2013-14-SC-UTT-36942).

      Declaration of competing interest

      None declared.

      Acknowledgement

      Our gratitude goes out to the respondents who took part in this study. We would like to extend our thanks to UPSACS (Uttar Pradesh State AIDS control society) for their cooperation. Authors also offer sincere thanks to all the patients and staffs of ART centre who participated in this research work. We want to thank Neeraj Dwivedi and Sandeep Patel for their help in data analysis.

      References

      1. NACO ANNUAL REPORT 2016-2017: National AIDS Control Organisation. NACO, 2016: 1-70
        • Mallal S.
        • Nolan D.
        • Witt C.
        • et al.
        Association between presence of HLA-B* 5701, HLA-DR7, and HLA-DQ3 and hypersensitivity to HIV-1 reverse-transcriptase inhibitor abacavir.
        Lancet. 2002; 359: 727-732
        • Hetherington S.
        • Hughes A.R.
        • Mosteller M.
        • et al.
        Genetic variations in HLA-B region and hypersensitivity reactions to abacavir.
        Lancet. 2002; 359: 1121-1122
        • Hughes A.R.
        • Mosteller M.
        • Bansal A.T.
        • et al.
        Association of genetic variations in HLA-B region with hypersensitivity to abacavir in some, but not all, populations.
        Pharmacogenomics. 2004; 5: 203-211
        • Orkin C.
        • Sadiq S.
        • Rice L.
        • Jackson F.
        • team U.E.
        Prospective epidemiological study of the prevalence of human leukocyte antigen (HLA)‐B* 5701 in HIV‐1‐infected UK subjects.
        HIV Med. 2010; 11: 187-192
        • Sun H.-Y.
        • Hung C.-C.
        • Lin P.-H.
        • et al.
        Incidence of abacavir hypersensitivity and its relationship with HLA-B* 5701 in HIV-infected patients in Taiwan.
        J Antimicrob Chemother. 2007; 60: 599-604
        • Puthanakit T.
        • Bunupuradah T.
        • Pope Kosalaraksa U.V.
        • et al.
        Prevalence of human leukocyte antigen-B* 5701 among HIV-infected children in Thailand and Cambodia: implications for abacavir use.
        Pediatr Infect Dis J. 2013; 32: 252
        • Balakrishnan K.
        • Pitchappan R.
        • Suzuki K.
        • Kumar U.S.
        • Santhakumari R.
        • Tokunaga K.
        HLA affinities of Iyers, a Brahmin population of Tamil Nadu, south India.
        Hum Biol. 1996; : 523-537
        • Umapathy S.
        • Pawar A.
        • Ghosh K.
        Specific human leukocyte antigen alleles associated with HIV-1 infection in an Indian population.
        J. Acquir. Immune Defic. Syndr. 2007; 44: 489-490
        • Shankarkumar U.
        • Sridharan B.
        • Pitchappan R.
        HLA diversity among Nadars, a primitive Dravidian caste of South India.
        Tissue Antigens. 2003; 62: 542-547
        • Dedhia L.
        • Gadekar S.
        • Mehta P.
        • Parekh S.
        HLA haplotype diversity in the South Indian population and its relevance.
        Indian Journal of Transplantation. 2015; 9: 138-143
        • Manglani M.V.
        • Gabhale Y.R.
        • Lala M.M.
        • Sekhar R.
        • More D.
        HLA-B* 5701 allele in HIV-infected Indian children and its association with abacavir hypersensitivity.
        Indian Pediatr. 2018; 55: 140-141
        • Robinson J.
        • Halliwell J.A.
        • McWilliam H.
        • Lopez R.
        • Parham P.
        • Marsh S.G.
        The imgt/hla database.
        Nucleic Acids Res. 2012; 41: D1222-D1227
        • Lin C.-Y.
        • Chen H.-C.
        • Lin R.-W.
        • et al.
        Quality assurance of genotyping array for detection and typing of human papillomavirus.
        J Virol Methods. 2007; 140: 1-9
        • Cascella R.
        • Strafella C.
        • Ragazzo M.
        • et al.
        Direct PCR: a new pharmacogenetic approach for the inexpensive testing of HLA-B* 57: 01.
        Pharmacogenomics J. 2015; 15: 196
        • Pavlos R.
        • Mallal S.
        • Ostrov D.
        • Pompeu Y.
        • Phillips E.
        Fever, rash, and systemic symptoms: understanding the role of virus and HLA in severe cutaneous drug allergy.
        J Allergy Clin Immunol Pract. 2014; 2: 21-33
        • Sooda A.
        • Rwandamuriye F.
        • Wanjalla C.N.
        • et al.
        Abacavir inhibits but does not cause self-reactivity to HLA-B* 57: 01-restricted EBV specific T cell receptors.
        Communications biology. 2022; 5: 1-13
        • Chakravarty J.
        • Sharma S.
        • Johri A.
        • Chourasia A.
        • Sundar S.
        Clinical abacavir hypersensitivity reaction among children in India.
        Indian J Pediatr. 2016; 83: 855-858
        • Rajalingam R.
        • Krausa P.
        • Shilling H.G.
        • et al.
        Distinctive KIR and HLA diversity in a panel of north Indian Hindus.
        Immunogenetics. 2002; 53: 1009-1019
        • Shankarkumar U.
        • Pawar A.
        • Gaonkar P.
        • Parasannavar D.
        • Salvi V.
        • Ghosh K.
        HLA allele associations in idiopathic recurrent spontaneous abortion patients from India.
        J Hum Reprod Sci. 2008; 1: 19
        • Rani R.
        • Marcos C.
        • Lazaro A.
        • Zhang Y.
        • Stastny P.
        Molecular diversity of HLA‐A,‐B and‐C alleles in a North Indian population as determined by PCR‐SSOP.
        Int J Immunogenet. 2007; 34: 201-208
        • Gonzalez-Galarza F.F.
        • Christmas S.
        • Middleton D.
        • Jones A.R.
        Allele frequency net: a database and online repository for immune gene frequencies in worldwide populations.
        Nucleic Acids Res. 2010; 39: D913-D919
        • Crawford M.H.
        • Reddy B.M.
        • Martinez-Laso J.
        • Mack S.J.
        • Erlich H.A.
        Genetic variation among the Golla pastoral caste subdivisions of Andhra Pradesh, India, according to the HLA system.
        Hum Immunol. 2001; 62: 1031-1041
        • Kankonkar S.
        • ShankarKumar U.
        Molecular diversity of HLA-A, HLA-B, HLA-DRB1 and HLA-DQB1 alleles from Mumbai India.
        Int J Hum Genet. 2012; 12: 57-62
        • Chaudhari D.V.
        • Chavan V.R.
        • Ahir S.P.
        • Kerkar S.C.
        • Mehta P.R.
        • Mania-Pramanik J.
        Human leukocyte antigen B distribution in HIV discordant cohort from India.
        Immunol Lett. 2013; 156: 1-6